D355a
27/04/2024 17:12 - Ctgtjvuba -
Komatsu-D355a dozers for sale. Browse all ads of used Komatsu-D355a Dozers machines for sale available on Mascus. You may sort the Komatsu-D355a Dozers ads by price, year of production, or country. Sort by |Best match. Komatsu D355A-1 Crawler Tractor dimensions. View size, weight and specifications for a variety of similar equipment from top manufacturers.Feb 24, 2019 ... An 85-ton, steel and concrete-reinforced Komatsu D355A bulldozer destroyed 13 buildings in June 2004 in Granby, Colorado. Patrick Brower ...Table of Content of the Komatsu Dozer D355A-3 Manual: 1. General Instructions. This section presents under one heading the basic information and procedures common to the sections on “Disassembly and Assembly”, “Testing and Adjustments”, “Troubleshooting”, and “Removal and Installation”. It is essential for the serviceman to ...Komatsu D355A dozer with ripper yellow version. Komatsu D355A dozer with ripper yellow version. Komatsu D355A dozer with ripper yellow version. Manufacturer: Diapet. Availability: In stock. SKU: DIAK-15K2. Manufacturer part number: K-15K2. $145.00 . …Learn about the infamous rampage of Marvin Heemeyer, who used a retrofitted Komatsu D355A bulldozer to destroy several buildings and vehicles in Granby, Colorado in 2004. Find out how he modified his bulldozer with armor, weapons and explosives, and how he was stopped by the police. See moreDetails for Komatsu SA6D155-4 D355A Engine (Plant) Stock ID. 2644. Manufacturer. Komatsu. Part Type. Engine (Plant) Condition. Good.: Get the latest Seven West Media stock price and detailed information including news, historical charts and realtime prices. Indices Commodities Currencies StocksKomatsu D355A "Killdozer", an armored bulldozer used in a rampage in Granby, Colorado 14 years ago today. Its armor was concrete between steel plates up to a foot thick in places, navigated by cctv, and had gunports for a .50, .308, and .22 long rifles.Watch as we load up this monster Komatsu D355 dozer on the trailer! Thanks @whistlindiesel for the inspiration! #killdozer #fs22 #jmdultimategamingThe machine was a Komatsu D355A Bulldozer, outfitted with an armour steel cap to fortify a madman from enemy attack. The tank-like vehicle was piloted by anger and revenge. Fabricated to fulfill a destiny and exact a price for years of pent up animosity for a perceived judgement on the behalf of the establishment.NordLocker is ensureing the security of cloud storage with its encryption to protect the data of small businesses and consumers. The launch of NordLocker’s cloud storage add-on com...Serous ovarian cancer is a gynecological tumor that is more common in women, and high-grade serous ovarian cancer (HGSOC) accounts for roughly 70% of ovarian cancer deaths [1, 2].As an aggressive ... 8. Standard shoe size. 711 mm. Special equipment comparison, Komatsu D355A-1 vs. Caterpillar D10 pros and cons - all this on portal pages dedicated to the world's best models of special equipment of . Fill it out as soon as possible, and be smart about how you do it. Going to college is all about filling out forms. Even before you get it, you have to fill out standardized tests,...Good shots of D355A remains. Thread starter LEGEND; Start date Jun 30, 2007; Prev. 1; 2; First Prev 2 of 2 Go to page. Go. E. EUCLIDES Member. Joined Jul 30, 2007 Messages 10 Location DOMINICAN REPUBLIC Occupation SERVICE ENGENEER Aug 6, 2007 #21 I agree . D. Dozer575 Banned. Joined Mar 2, 2007 Messages 274The Liberty Maniacs Men's department is the largest and most extensive collection of Men's apparel and accessories for liberty-loving gentlemen on Earth. You'll find shirts, pants, athletic gear, hats, and sweatshirts, outerwear, in a huge inventory updated daily and shipping worldwide. Tagged "Komatsu D355A bulldozer".Aug 29, 2020 ... Bulldozer Komatsu D355A-3 3D model, available formats OBJ, build bulldoser, ready for 3D animation and other 3D projects.View Details. 39 1. Updated: Wednesday, March 13, 2024 09:30 AM. Lot #: 15279. KOMATSU D39EX. Crawler Dozers. View Buyer's Premium. …1985 komatsu d355a-3. used. manufacturer: komatsu model: d355a-3 we have (1) komatsu d355a-3 transmission which are dyno tested by komatsu dealer.we will provide you document from komatsu dealer here is the parts number for these two transmissions: part number: 195-15-00018 ser...American Airlines AAdvantage Platinum Pro offers a variety of seating privileges, as well as unlimited domestic complimentary upgrades. We may be compensated when you click on prod...performance Komatsu D355A bull-dozer is used in the D355C pipelayer. As a result, the D355C takes shocks and stressin stride, Center track- – roller guards prevent rocks and other abrasive items from entering in be-– tween track roller and links. Grooved type floating seals keep lubricant in, dirt out of track rollers and idlers. Other featuresDescription. Bulldozer Komatsu D355A-3 The bulldozer was used for the destruction of the GRANBY town by Marvin Heemeyer. lwo, obj, 3D max. bulldozer. build. bulldoser. koma. model. vehicle.Standard Shoe Size. 24.1 in. Track Gauge. 7.5 ft. Track Pitch. 10.3 in. Specs for the Komatsu D355A-5. Find equipment specs and information for this and other Crawler Dozers. Use our comparison ... Transporting a Komatsu D355A-3 Crawler Tractor is a process that involves multiple steps, each requiring careful attention and expertise. First, the Komatsu D355A-3 Crawler Tractor is prepared for transport, which may involve disassembling larger components and securing fragile parts.During the loading phase, special equipment like forklifts or cranes may be used How to properly tie a tie proves to be a challenge well into adulthood.Komatsu D355A-3 for sale - Spain - Mascus UK.It started with a Komatsu D355A bulldozer, fitted with makeshift armor of concrete sandwiched between steel plates. The armor could be as thick as one foot, and it covered the cabin, the engine, and parts of the tracks. The armor completely covered the window of the cabin, but Heemeyer installed cameras linked to a monitor on his …🚜 Get ready for an adrenaline-pumping adventure as we dive into the world of heavy machinery with the Komatsu D355A, affectionately known as the "Killdozer"...Learn about the features and performance of the Komatsu D355A-1 crawler tractor, a powerful and versatile machine for construction and mining. Find out its engine, …You've come to the right place. We sell a wide range of new aftermarket, used and rebuilt D355A replacement booms and sticks to get your machine back up and running quickly. Give us a call, submit an online quote request or select a category below to browse/select a part. Click to Start a Komatsu D355A Part Quote Online OR call 1-800-255-6253.Myc‐CtBP1‐S D355A was generated using the QuikChangeR site‐directed mutagenesis kit (Stratagene) with the primers 5′‐CTGGGCCAGCATGGCCCCTGCTGTGGTG‐3′ and 5′‐CACCACAGCAGGGGCCATGCTGGCCCAG‐3′ (Bonazzi et al, 2005). The cDNA was verified by sequencing. PAK1 WT and inhibitory domain expression vectors were from J Chernoff (Fox ...Jan 21, 2024 ... Was this you? @whistlindiesel Follow @ethansgarage1 "SCP-x4x (Mind Leech)" Kevin MacLeod (incompetech.com)Licensed under Creative Commons: ...Join 9,360,000 engineers with over 4,850,000 free CAD files Join the Community. Recent All time. Category. Software. Tag: komatsu ×. The GrabCAD Library offers millions of free CAD designs, CAD files, and 3D models. Join the GrabCAD Community today to …The Insider Trading Activity of Shapiro Glenn T on Markets Insider. Indices Commodities Currencies Stocksif I can use this card for IRC5 controllers can then somebody send me the correct card definition? for a dsqc 355A it looks like following text: -Name "d355A" -BusType "DNET" -VendorName "ABB Robotics". -ProductName "Analog Unit" -DN_VendorId 75 -DN_ProductCode 10. -DN_DeviceType 100 -DN_MajorRev 1 -DN_ExplicitMsgEnabled.May 16, 2020 ... 38 likes, 1 comments - kingdomofspiders on May 16, 2020: "Killdozer v2.0 now build on a 1:64 Komatsu d355a body for accuracy .bulldozer Excavator D355A 1/50 Komatsu. japanbox1 (84) 100% positive; Seller's other items Seller's other items; Contact seller; US $89.00. or Best Offer. Condition: Used UsedTransportation of goods is necessary for a healthy trading system. Read this article and find out 5 green methods of transporting goods. Advertisement Kermit the Frog said it best:...Model of a Komatsu D355A bulldozer. The Killdozer is actually a Komatsu D355A bulldozer. When Heemeyer had bought it, the machine weighed 49 tons. By the time he was …The rails on a D355 should be 10.25 pitch, 88mm bushing OD where D9G/H uses similar at 10.25 pitch 89mm OD. Could be a direct interchange without sprocket wear. FA41B trans pinion breakage was issue and steering clutch-brake drum wear (sticky release) after 3,000hrs usage.🚜 Get ready for an adrenaline-pumping adventure as we dive into the world of heavy machinery with the Komatsu D355A, affectionately known as the "Killdozer"...Fill it out as soon as possible, and be smart about how you do it. Going to college is all about filling out forms. Even before you get it, you have to fill out standardized tests,...Learn about the Komatsu D355A-1 Crawler Tractor, a heavy-duty machine for construction, mining, and other industries. Find out its dimensions, …7.0. Standard Shoe Size: 24.1 in (61 cm) Track Gauge: 7.5 ft (2 m) Komatsu D355A-3 Crawler Dozer power, features, specification, mileage and price.Get Komatsu D355A-5 Bulldozer Rental Services in Kolhapur, Maharashtra at best price by Digambar M Medshinge Earthmovers. Also find Komatsu Dozer price list ... Komatsu Equipment is a subsidiary of Komatsu Ltd, the second largest leader in supplying and manufacturing earth-moving, construction, and mining equipment. Komatsu began its journey in 1917 in Japan. The company received its name Komatsu after the city of the same name. In English, the name “Komatsu” means “little pine tree” and honors ... The machine was a Komatsu D355A Bulldozer, outfitted with an armour steel cap to fortify a madman from enemy attack. The tank-like vehicle was piloted by anger and revenge. Fabricated to fulfill a destiny and exact a price for years of pent up animosity for a perceived judgement on the behalf of the establishment.5 reasons to buy Komatsu D355A-3: Standard blade. Cut depth: 700 mm and 674 mm: 4 % more or 26 mm: Gear box. Forward gears number: 4 and 3: 25 % more or 1 : Reverse gears number: 4 and 3: 25 % more or 1 : Maximum forward speed: 12.7 km/h and 12.5 km/h: 2 % more or 0.2 km/h: Carrier. Specific ground pressure:Learn about the features and performance of the Komatsu D355A-1 crawler tractor, a powerful and versatile machine for construction and mining. Find out its engine, …Marvin Heemeyer goes on a rampage with a 50-ton armour-plated Komatsu D355A bulldozer in Granby,Colorado resulting in 13 buildings destroyed and $7 million in …KOMATSU FH50 V1.0.0.1. Forklifts and Excavators. August 10, 2023. Page 1 of 3 1 2 3 ». Komatsu mods for Farming simulator 22 download.Komatsu Loadflex for FS19 by Komatsuloadflex, North Modding Company. Mod has a rating of 4.5 stars. We host 1 file ( Komatsu895_Loadflex.zip) for this mod. We confirm that the file is safe to download. The total downloadable file is 44 MB in …Date First Available : . Manufacturer : . ASIN : B0C2F6BM7C. Part Number: 6502-12-9005 6502-12-9004 Application: Compatible with D355A-5 D355A-3 Engine 6D155-4 Package Includes: 1pc Turbocharger Turbo Model: KTR110M-532AW SA6D155-4A S/N 50816-UP D355A-5 S/N 12622-UP D355A-3 S/N 1010-UP. To report an issue with this product,Komatsu Excavator Mega Pack v1.0 FS22. It’s finally here! My Komatsu excavator pack is ready for a proper release! I have put countless hours into making the machines in this pack, and getting them as detailed as possible. All models except the 400 and 450 come with a Werk-Brau coupler and thumb, and most have IC controls for the cabin and ...Table of Content of the Komatsu Dozer D355A-3 Manual: 1. General Instructions. This section presents under one heading the basic information and procedures common to the sections on “Disassembly and Assembly”, “Testing and Adjustments”, “Troubleshooting”, and “Removal and Installation”. It is essential for the serviceman to ...if I can use this card for IRC5 controllers can then somebody send me the correct card definition? for a dsqc 355A it looks like following text: -Name "d355A" -BusType "DNET" -VendorName "ABB Robotics". -ProductName "Analog Unit" -DN_VendorId 75 -DN_ProductCode 10. -DN_DeviceType 100 -DN_MajorRev 1 -DN_ExplicitMsgEnabled.There are times when the anti-lock brake warning light may come on on your car's dashboard when the brakes are in good condition. It may even happen after you have recently had the...Komatsu D375A Mining Dozer V1.0. October 25, 2023 in Forklifts and Excavators. -Colorable Parts. -Functional Ripper.DISASSEMBLY AND ASSEMBLY DOZER D355A-5 This section explains the order to be followed when removing, installing, disassembling or assembling each component, as well as precautions to be taken for these operations. MAINTENANCE STANDARD This section gives the judgement standards when inspecting disassembled parts. 1. When removing the connectors ...Komatsu Excavator Mega Pack v1.0 FS22. It’s finally here! My Komatsu excavator pack is ready for a proper release! I have put countless hours into making the machines in this pack, and getting them as detailed as possible. All models except the 400 and 450 come with a Werk-Brau coupler and thumb, and most have IC controls for the cabin and ...Explore the future of transportation through the interactive above. Explore the future of transportation through the interactive above. Natural gas as a transport fuel is not a new...Sizes. Length with blade. 9200 mm and 7240 mm. Width between caterpillar tracks. 3030 mm and 3020 mm. Height to cab upper part. 4125 mm and 3560 mm. Caterpillar track length on ground level. 3360 mm and 3350 mm. 8. Standard shoe size. 711 mm. Special equipment comparison, Komatsu D355A-1 vs. Caterpillar D10 pros and cons - all this on portal pages dedicated to the world's best models of special equipment of . Feb 8, 2022 · Instead, Marvin Heemeyer went home, outfitted his Komatsu D355A bulldozer with armored plates, a layer of concrete, and bulletproof plastic, and drove it through the town in a rampage, knocking down 13 buildings and causing $7 million worth of damage with his makeshift “killdozer.” This is the shocking true story of Marvin Heemeyer’s revenge. Transporting a Komatsu D355A-3 Crawler Tractor is a process that involves multiple steps, each requiring careful attention and expertise. First, the Komatsu D355A-3 Crawler Tractor is prepared for transport, which may involve disassembling larger components and securing fragile parts.During the loading phase, special equipment like forklifts or cranes may be used Standard Shoe Size. 24.1 in. Track Gauge. 7.5 ft. Track Pitch. 10.3 in. Specs for the Komatsu D355A-5. Find equipment specs and information for this and other Crawler Dozers. Use our comparison ... 1985 komatsu d355a-3. used. manufacturer: komatsu model: d355a-3 we have (1)komatsu d355a-3 transmission which are dyno tested by komatsu dealer.we will provide you document from komatsu dealer here is the parts number for these two transmissions: part number: 195-15-00018 ser... SPRUCE GROVE, Alberta, Canada T7X 3B4. Phone: +1 780-962-8586. View Details. Email Seller Video Chat. Get Shipping Quotes. 8. Standard shoe size. 711 mm. Special equipment comparison, Komatsu D355A-1 vs. Caterpillar D10 pros and cons - all this on portal pages dedicated to the world's best models of special equipment of . bulldozer Excavator D355A 1/50 Komatsu. japanbox1 (84) 100% positive; Seller's other items Seller's other items; Contact seller; US $89.00. or Best Offer. Condition: Used UsedThe video transcript discusses the challenges of hauling a large bulldozer, which needs to be disassembled due to its 15-foot width. The blade and ripper cla...Scale. Condition. Buying Format. Delivery Options. All Filters. New! Komatsu WF450-3 compactor 1/50 Diecast Model CONRAD f/s from Japan. $128.00. Free shipping.Winwin Used Machinery. Seoul, South Korea 05838. Phone: +82 2-553-7007. View Details. Contact Us. Stock ID : 101017-01 Used Bulldozer KOMATSU D355A 1987yr For sale Bulldozer KOMATSU D355A 1987yr Good condition Location : Korea CONTACT US Winwin Used Machinery Mobile : + (Sims...See More Details.Learn about the features, performance, and maintenance of the Komatsu D355a bulldozer, a powerful and …1979 KOMATSU D355A-3: Make: KOMATSU: Price: $99,000 inc GST ONO: Listing Type: Used: RefCode: DIY1046315: Net Engine Power SAE Rated - kW: 308: Hours: 3993: Track Shoe Width - mm: 610: Operating Weight Without Ripper - kg: 53000: Description. Final drives not showing any oil leaks or casting damage upon close inspection. Oil levels … 1985 komatsu d355a-3. used. manufacturer: komatsu model: d355a-3 we have (1)komatsu d355a-3 transmission which are dyno tested by komatsu dealer.we will provide you document from komatsu dealer here is the parts number for these two transmissions: part number: 195-15-00018 ser... Komatsu D355A-1 Operating Specifications. Cooling System Fluid Capacity: 45 gal (170 l) Operating Weight: 97907.3 lbs (44,411 kg) Komatsu D355A-1 Standard Blade. In this week's Actuator, we look at Tesla's new robotic prototype, potential headwinds for the Amazon/iRobot deal and Jay-Z's new obsession with pizza robots. I sat out Friday’s bi...Financial planning experts recommend that an investment portfolio balance holdings among stocks, bonds and cash. The stock holdings are the equity portion of a portfolio. Bonds are...Sizes. Length with blade. 9200 mm and 7240 mm. Width between caterpillar tracks. 3030 mm and 3020 mm. Height to cab upper part. 4125 mm and 3560 mm. Caterpillar track length on ground level. 3360 mm and 3350 mm.Date First Available : . Manufacturer : . ASIN : B0C2F6BM7C. Part Number: 6502-12-9005 6502-12-9004 Application: Compatible with D355A-5 D355A-3 Engine 6D155-4 Package Includes: 1pc Turbocharger Turbo Model: KTR110M-532AW SA6D155-4A S/N 50816-UP D355A-5 S/N 12622-UP D355A-3 S/N 1010-UP. To report an issue with this product,Browse Komatsu D355A-1 Dozers For Sale near you on MyLittleSalesman.com. Find the best priced Komatsu D355A-1 Dozers by owners and dealers.Sizes. Length with blade. 9200 mm and 7240 mm. Width between caterpillar tracks. 3030 mm and 3020 mm. Height to cab upper part. 4125 mm and 3560 mm. Caterpillar track length on ground level. 3360 mm and 3350 mm.1979 KOMATSU D355A-3: Make: KOMATSU: Price: $99,000 inc GST ONO: Listing Type: Used: RefCode: DIY1046315: Net Engine Power SAE Rated - kW: 308: Hours: 3993: Track Shoe Width - mm: 610: Operating Weight Without Ripper - kg: 53000: Description. Final drives not showing any oil leaks or casting damage upon close inspection. Oil levels …-Colorable Parts Credits: FS Miner Download mod File File size FS22_Komatsu_D355C_FSM 26 MB1985 komatsu d355a-3. used. manufacturer: komatsu model: d355a-3 we have (1)komatsu d355a-3 transmission which are dyno tested by komatsu dealer.we will provide you document from komatsu dealer here is the parts number for these two transmissions: part number: 195-15-00018 ser...Komatsu D355A-3 Bulldozers - Heavy Equipment (Construction Machinery) Specifications Weight and Dimensions ( approx ., according to spec sheet/brochure): View PDF Bochure: D355A-3__HBuy Hydraulic Pump 175-13-23500 for Komatsu D355A-3X D85A-21-E D75A-1 D65S-6 D65S-7: Oil Pumps - Amazon.com FREE DELIVERY possible on eligible purchasesStandard Shoe Size. 24.1 in. Track Gauge. 7.5 ft. Track Pitch. 10.3 in. Specs for the Komatsu D355A-5. Find equipment specs and information for this and other Crawler Dozers. Use our comparison ...137.2K Likes, 873 Comments. TikTok video from Brian Mello (@realbrianmello): “Whistlindiesel’s Epic New Toy! | #whistlingdiesel #komatsu #dieselpower #dieseltrucks @Whistlindiesel”. komatsu d355a bulldozer. original sound - Brian Mello.We looked at millennials' credit card habits to find the places where millennials have the most credit card debt and where they struggle to pay it off... Calculators Helpful Guides... Winwin Used Machinery. Seoul, South Korea 05838. Phone: +82 2-553-7007. Stock ID : 101017-01 Used Bulldozer KOMATSU D355A 1987yr For sale Bulldozer KOMATSU D355A 1987yr Good condition Location : Korea CONTACT US Winwin Used Machinery Mobile : + (Sims...See More Details. bulldozer Excavator D355A 1/50 Komatsu. japanbox1 (84) 100% positive; Seller's other items Seller's other items; Contact seller; US $89.00. or Best Offer. Condition: Used UsedKomatsu D355A dozer with ripper yellow version. Komatsu D355A dozer with ripper yellow version. Komatsu D355A dozer with ripper yellow version. Manufacturer: Diapet. Availability: In stock. SKU: DIAK-15K2. Manufacturer part number: K-15K2. $145.00 . … 킬도저는 코마츠 사의 d355a 불도저의 조종석, 엔진룸, 그리고 궤도 일부분 등에 장갑판을 설치하였고 몇 개의 총안구가 뚫린 형태였다. 장갑은 여러 장의 공구용 강철판 사이에 5000psi의 콘크리트 [3] 를 주입해 만들어진 사제 복합장갑 으로, 최대 약 300mm 두께의 ... Colorado (1) Find New Or Used Komatsu D355A Equipment for Sale from across the nation on EquipmentTrader.com. We offer the best selection of Komatsu D355A …Jan 20, 2024 ... 318.3K Likes, 2.9K Comments. TikTok video from Dig it starnes (@dig_it_starnes_): “Explore the incredible world of heavy equipment as ...Jun 20, 2023 · The Incident: Marvin Heemeyer’s bulldozer rampage occurred on June 4, 2004, when he heavily modified a Komatsu D355A bulldozer, turning it into an armored machine fortified with layers of steel and concrete. Heemeyer then went on a destructive spree, targeting several buildings in the town of Granby before ultimately taking his own life. Scale. Condition. Buying Format. Delivery Options. All Filters. New! Komatsu WF450-3 compactor 1/50 Diecast Model CONRAD f/s from Japan. $128.00. Free shipping.7. Standard Shoe Size. 24.1 in. Track Gauge. 7.5 ft. Track Pitch. 10.3 in. Specs for the Komatsu D355A-3. Find equipment specs and information for this and other Crawler Dozers.50,000 lbs, Dozer Rentals. 15,000 lbs - 200,000 lbs. 80,000 lbs, Dozer Rentals. 15,000 lbs - 200,000 lbs. SEE ALL EQUIPMENT ON DOZR. The "PX" refers to the track width which would be a low-ground-pressure model. If instead, it has an "EX", that means the Komatsu dozer will be equipped with standard tracks.Discover expert strategies for navigating the investment landscape and securing capital. Receive Stories from @muzammilrawjaniJul 1, 2007. #6. Looks like a fitting end to a fair to bad piece of equipment. Doesn't look as tho it had real good maintenance, and "A" model 355's were maintenance intensive. Very prone to bust final drives. It looks like there is a mine off in the distance a ways behind the dozer in one or two of the pictures.Mar 16, 2018 · 'Tales From the Bottle' tells the tale of the KILLDOZER, the man who made it, and the why, the what and the how. "Marvin John Heemeyer (October 28, 1951 – Ju... The Mummy Bumper Magnet - Honk if you'd rather - Bumper Sticker Alternative, 1999, Cinematic Masterpiece, Brendan Fraser, Rachel Weisz. SpecificHonks. $19.51. StickerBongo. $6.47.Komatsu D355A-5 Crawler. $57,000. 4715 m/h. Japan, Chiba ken. Favourites : 0 Comparison : 0. Komatsu D355 bulldozers Price from €52,000 New and used Trusted sellers Currently in stock Quality construction equipment for sale at Machineryline USA.Track width. 2550 mm. 8. Standard shoe size. 610 mm. 8. Standard shoe size. 610 mm. Special equipment comparison, Komatsu D355A-3 vs. Caterpillar D10R pros and cons - all this on portal pages dedicated to the world's best models of special equipment of .57 000 USD. 4715 m/h. Japonsko, Chiba ken. Obľúbené : 0 Porovnanie : 0. Buldozéry Komatsu D355 Cena od 52 000 € Nové a použité Dôveryhodní predajcovia Momentálne na sklade Kvalitné stavebné stroje na predaj na Machineryline Slovensko. 7. Standard Shoe Size. 24.1 in. Track Gauge. 7.5 ft. Track Pitch. 10.3 in. Specs for the Komatsu D355A-3. Find equipment specs and information for this and other Crawler Dozers. Seoul, South Korea 05838. Phone: +82 2-553-7007. View Details. Stock ID : 101017-01 Used Bulldozer KOMATSU D355A 1987yr For sale Bulldozer KOMATSU D355A 1987yr Good condition Location : Korea CONTACT US Winwin Used Machinery Mobile : + (Sims...See More Details. Winwin Used Machinery. Seoul, South Korea 05838. Phone: +82 2-553-7007. Stock ID : 101017-01 Used Bulldozer KOMATSU D355A 1987yr For sale Bulldozer KOMATSU D355A 1987yr Good condition Location : Korea CONTACT US Winwin Used Machinery Mobile : + (Sims...See More Details. Komatsu D355A-5 Crawler. $57,000. 4715 m/h. Japan, Chiba ken. Favourites : 0 Comparison : 0. Komatsu D355 bulldozers Price from €52,000 New and used Trusted sellers Currently in stock Quality construction equipment for sale at Machineryline USA. | Cirjxcn (article) | Mwmwyflu.